ID: 1202445100

View in Genome Browser
Species Human (GRCh38)
Location Y:24950249-24950271
Sequence TCAAGCGGGCCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202445100_1202445109 0 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445109 Y:24950272-24950294 GTTCCGGGTGGGTGTGGGCTTGG 0: 63
1: 709
2: 625
3: 344
4: 428
1202445100_1202445112 15 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445112 Y:24950287-24950309 GGGCTTGGCAGGCCCGCACTCGG No data
1202445100_1202445107 -6 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445107 Y:24950266-24950288 GCTTGAGTTCCGGGTGGGTGTGG No data
1202445100_1202445108 -5 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445108 Y:24950267-24950289 CTTGAGTTCCGGGTGGGTGTGGG No data
1202445100_1202445111 4 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445111 Y:24950276-24950298 CGGGTGGGTGTGGGCTTGGCAGG 0: 26
1: 421
2: 518
3: 423
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202445100 Original CRISPR TCAAGCGGGCCCGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr