ID: 1202445108

View in Genome Browser
Species Human (GRCh38)
Location Y:24950267-24950289
Sequence CTTGAGTTCCGGGTGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202445100_1202445108 -5 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445108 Y:24950267-24950289 CTTGAGTTCCGGGTGGGTGTGGG No data
1202445099_1202445108 -4 Left 1202445099 Y:24950248-24950270 CCCGGCGCTTGCGGGCCCGCTTG No data
Right 1202445108 Y:24950267-24950289 CTTGAGTTCCGGGTGGGTGTGGG No data
1202445096_1202445108 7 Left 1202445096 Y:24950237-24950259 CCGGGGCTGCTCCCGGCGCTTGC No data
Right 1202445108 Y:24950267-24950289 CTTGAGTTCCGGGTGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202445108 Original CRISPR CTTGAGTTCCGGGTGGGTGT GGG Intergenic
No off target data available for this crispr