ID: 1202445109

View in Genome Browser
Species Human (GRCh38)
Location Y:24950272-24950294
Sequence GTTCCGGGTGGGTGTGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2169
Summary {0: 63, 1: 709, 2: 625, 3: 344, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202445096_1202445109 12 Left 1202445096 Y:24950237-24950259 CCGGGGCTGCTCCCGGCGCTTGC No data
Right 1202445109 Y:24950272-24950294 GTTCCGGGTGGGTGTGGGCTTGG 0: 63
1: 709
2: 625
3: 344
4: 428
1202445100_1202445109 0 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445109 Y:24950272-24950294 GTTCCGGGTGGGTGTGGGCTTGG 0: 63
1: 709
2: 625
3: 344
4: 428
1202445099_1202445109 1 Left 1202445099 Y:24950248-24950270 CCCGGCGCTTGCGGGCCCGCTTG No data
Right 1202445109 Y:24950272-24950294 GTTCCGGGTGGGTGTGGGCTTGG 0: 63
1: 709
2: 625
3: 344
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202445109 Original CRISPR GTTCCGGGTGGGTGTGGGCT TGG Intergenic
Too many off-targets to display for this crispr