ID: 1202445111

View in Genome Browser
Species Human (GRCh38)
Location Y:24950276-24950298
Sequence CGGGTGGGTGTGGGCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2094
Summary {0: 26, 1: 421, 2: 518, 3: 423, 4: 706}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202445105_1202445111 -10 Left 1202445105 Y:24950263-24950285 CCCGCTTGAGTTCCGGGTGGGTG No data
Right 1202445111 Y:24950276-24950298 CGGGTGGGTGTGGGCTTGGCAGG 0: 26
1: 421
2: 518
3: 423
4: 706
1202445100_1202445111 4 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445111 Y:24950276-24950298 CGGGTGGGTGTGGGCTTGGCAGG 0: 26
1: 421
2: 518
3: 423
4: 706
1202445099_1202445111 5 Left 1202445099 Y:24950248-24950270 CCCGGCGCTTGCGGGCCCGCTTG No data
Right 1202445111 Y:24950276-24950298 CGGGTGGGTGTGGGCTTGGCAGG 0: 26
1: 421
2: 518
3: 423
4: 706
1202445096_1202445111 16 Left 1202445096 Y:24950237-24950259 CCGGGGCTGCTCCCGGCGCTTGC No data
Right 1202445111 Y:24950276-24950298 CGGGTGGGTGTGGGCTTGGCAGG 0: 26
1: 421
2: 518
3: 423
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202445111 Original CRISPR CGGGTGGGTGTGGGCTTGGC AGG Intergenic
Too many off-targets to display for this crispr