ID: 1202445112

View in Genome Browser
Species Human (GRCh38)
Location Y:24950287-24950309
Sequence GGGCTTGGCAGGCCCGCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202445099_1202445112 16 Left 1202445099 Y:24950248-24950270 CCCGGCGCTTGCGGGCCCGCTTG No data
Right 1202445112 Y:24950287-24950309 GGGCTTGGCAGGCCCGCACTCGG No data
1202445100_1202445112 15 Left 1202445100 Y:24950249-24950271 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202445112 Y:24950287-24950309 GGGCTTGGCAGGCCCGCACTCGG No data
1202445106_1202445112 0 Left 1202445106 Y:24950264-24950286 CCGCTTGAGTTCCGGGTGGGTGT No data
Right 1202445112 Y:24950287-24950309 GGGCTTGGCAGGCCCGCACTCGG No data
1202445096_1202445112 27 Left 1202445096 Y:24950237-24950259 CCGGGGCTGCTCCCGGCGCTTGC No data
Right 1202445112 Y:24950287-24950309 GGGCTTGGCAGGCCCGCACTCGG No data
1202445105_1202445112 1 Left 1202445105 Y:24950263-24950285 CCCGCTTGAGTTCCGGGTGGGTG No data
Right 1202445112 Y:24950287-24950309 GGGCTTGGCAGGCCCGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202445112 Original CRISPR GGGCTTGGCAGGCCCGCACT CGG Intergenic
No off target data available for this crispr