ID: 1202446786

View in Genome Browser
Species Human (GRCh38)
Location Y:24962455-24962477
Sequence GGGCGAAGGATGCTGAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202446786_1202446795 13 Left 1202446786 Y:24962455-24962477 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202446795 Y:24962491-24962513 AGCATCCTGGCTTTCTTTGAGGG No data
1202446786_1202446792 0 Left 1202446786 Y:24962455-24962477 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202446792 Y:24962478-24962500 TTTTTCTGGTGCCAGCATCCTGG No data
1202446786_1202446794 12 Left 1202446786 Y:24962455-24962477 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202446794 Y:24962490-24962512 CAGCATCCTGGCTTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202446786 Original CRISPR GGGCGAAGGATGCTGAGCAT GGG (reversed) Intergenic
No off target data available for this crispr