ID: 1202447573

View in Genome Browser
Species Human (GRCh38)
Location Y:24971277-24971299
Sequence CCGTGGTGGCATGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202447570_1202447573 -9 Left 1202447570 Y:24971263-24971285 CCAAATCTTGCTGACCGTGGTGG No data
Right 1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG No data
1202447565_1202447573 10 Left 1202447565 Y:24971244-24971266 CCTGTCTCTACAAAAACCCCCAA No data
Right 1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG No data
1202447568_1202447573 -7 Left 1202447568 Y:24971261-24971283 CCCCAAATCTTGCTGACCGTGGT No data
Right 1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG No data
1202447569_1202447573 -8 Left 1202447569 Y:24971262-24971284 CCCAAATCTTGCTGACCGTGGTG No data
Right 1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG No data
1202447564_1202447573 11 Left 1202447564 Y:24971243-24971265 CCCTGTCTCTACAAAAACCCCCA No data
Right 1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG No data
1202447566_1202447573 -6 Left 1202447566 Y:24971260-24971282 CCCCCAAATCTTGCTGACCGTGG No data
Right 1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202447573 Original CRISPR CCGTGGTGGCATGCACCTGC AGG Intergenic
No off target data available for this crispr