ID: 1202457082

View in Genome Browser
Species Human (GRCh38)
Location Y:25068913-25068935
Sequence TATAATCCCCAGTGGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202457079_1202457082 22 Left 1202457079 Y:25068868-25068890 CCAGGCAAGAGAGTCATATCATT 0: 10
1: 17
2: 34
3: 84
4: 300
Right 1202457082 Y:25068913-25068935 TATAATCCCCAGTGGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202457082 Original CRISPR TATAATCCCCAGTGGAAGCA GGG Intergenic
No off target data available for this crispr