ID: 1202458946

View in Genome Browser
Species Human (GRCh38)
Location Y:25087853-25087875
Sequence AAGCCAGATGGTCCTTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202458946_1202458952 -4 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458952 Y:25087872-25087894 GCTTAAAGGTTAGTTAATGGAGG No data
1202458946_1202458953 -1 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458953 Y:25087875-25087897 TAAAGGTTAGTTAATGGAGGTGG No data
1202458946_1202458956 18 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458956 Y:25087894-25087916 GTGGGGTAAAAAAACTTAATTGG No data
1202458946_1202458954 0 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458954 Y:25087876-25087898 AAAGGTTAGTTAATGGAGGTGGG 0: 36
1: 18
2: 10
3: 16
4: 190
1202458946_1202458955 1 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458955 Y:25087877-25087899 AAGGTTAGTTAATGGAGGTGGGG 0: 4
1: 27
2: 17
3: 19
4: 161
1202458946_1202458958 20 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458958 Y:25087896-25087918 GGGGTAAAAAAACTTAATTGGGG No data
1202458946_1202458957 19 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458957 Y:25087895-25087917 TGGGGTAAAAAAACTTAATTGGG No data
1202458946_1202458951 -7 Left 1202458946 Y:25087853-25087875 CCCCAGAAAGGACCATCTGGCTT No data
Right 1202458951 Y:25087869-25087891 CTGGCTTAAAGGTTAGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202458946 Original CRISPR AAGCCAGATGGTCCTTTCTG GGG (reversed) Intergenic
No off target data available for this crispr