ID: 1202464730

View in Genome Browser
Species Human (GRCh38)
Location Y:25143384-25143406
Sequence CTGTGTGAGTCCAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202464730_1202464734 18 Left 1202464730 Y:25143384-25143406 CCCTCATACTTGGACTCACACAG No data
Right 1202464734 Y:25143425-25143447 CAGAGCCATGGGTAAAGTCCTGG No data
1202464730_1202464733 7 Left 1202464730 Y:25143384-25143406 CCCTCATACTTGGACTCACACAG No data
Right 1202464733 Y:25143414-25143436 ATTTTGACTCTCAGAGCCATGGG No data
1202464730_1202464732 6 Left 1202464730 Y:25143384-25143406 CCCTCATACTTGGACTCACACAG No data
Right 1202464732 Y:25143413-25143435 TATTTTGACTCTCAGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202464730 Original CRISPR CTGTGTGAGTCCAAGTATGA GGG (reversed) Intergenic
No off target data available for this crispr