ID: 1202465578

View in Genome Browser
Species Human (GRCh38)
Location Y:25151318-25151340
Sequence GAGTCACTTCACCTGGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202465578_1202465580 -6 Left 1202465578 Y:25151318-25151340 CCAGTAGCCAGGTGAAGTGACTC No data
Right 1202465580 Y:25151335-25151357 TGACTCTTCTTCCAGAGTCCTGG No data
1202465578_1202465583 23 Left 1202465578 Y:25151318-25151340 CCAGTAGCCAGGTGAAGTGACTC No data
Right 1202465583 Y:25151364-25151386 GAAAGATTGTGACATCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202465578 Original CRISPR GAGTCACTTCACCTGGCTAC TGG (reversed) Intergenic
No off target data available for this crispr