ID: 1202466069

View in Genome Browser
Species Human (GRCh38)
Location Y:25156298-25156320
Sequence CTAATAATGACAATTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202466062_1202466069 21 Left 1202466062 Y:25156254-25156276 CCAGAGGTGATACTGTTCCATAT No data
Right 1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG No data
1202466060_1202466069 26 Left 1202466060 Y:25156249-25156271 CCCTGCCAGAGGTGATACTGTTC No data
Right 1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG No data
1202466065_1202466069 -10 Left 1202466065 Y:25156285-25156307 CCAGACCGAAACCCTAATAATGA No data
Right 1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG No data
1202466064_1202466069 -3 Left 1202466064 Y:25156278-25156300 CCTGAGACCAGACCGAAACCCTA No data
Right 1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG No data
1202466061_1202466069 25 Left 1202466061 Y:25156250-25156272 CCTGCCAGAGGTGATACTGTTCC No data
Right 1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG No data
1202466063_1202466069 4 Left 1202466063 Y:25156271-25156293 CCATATACCTGAGACCAGACCGA No data
Right 1202466069 Y:25156298-25156320 CTAATAATGACAATTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202466069 Original CRISPR CTAATAATGACAATTGTACC TGG Intergenic
No off target data available for this crispr