ID: 1202470172

View in Genome Browser
Species Human (GRCh38)
Location Y:25200419-25200441
Sequence TCCAGGGCCATTCCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202470172_1202470176 11 Left 1202470172 Y:25200419-25200441 CCTCTTTGAGGAATGGCCCTGGA No data
Right 1202470176 Y:25200453-25200475 ATCAGTGATGTGCCTGGCCTAGG No data
1202470172_1202470175 5 Left 1202470172 Y:25200419-25200441 CCTCTTTGAGGAATGGCCCTGGA No data
Right 1202470175 Y:25200447-25200469 AGTATCATCAGTGATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202470172 Original CRISPR TCCAGGGCCATTCCTCAAAG AGG (reversed) Intergenic
No off target data available for this crispr