ID: 1202471921

View in Genome Browser
Species Human (GRCh38)
Location Y:25216898-25216920
Sequence TCACCAAGCCTGCTATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202471920_1202471921 -9 Left 1202471920 Y:25216884-25216906 CCTGAAATAGTATGTCACCAAGC No data
Right 1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG No data
1202471918_1202471921 2 Left 1202471918 Y:25216873-25216895 CCTGGATACACCCTGAAATAGTA No data
Right 1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG No data
1202471916_1202471921 23 Left 1202471916 Y:25216852-25216874 CCTATTTGGAAAATCACACAACC No data
Right 1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG No data
1202471919_1202471921 -8 Left 1202471919 Y:25216883-25216905 CCCTGAAATAGTATGTCACCAAG No data
Right 1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202471921 Original CRISPR TCACCAAGCCTGCTATAGAC AGG Intergenic
No off target data available for this crispr