ID: 1202484898

View in Genome Browser
Species Human (GRCh38)
Location Y:25344089-25344111
Sequence ATGGCTCCACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202484896_1202484898 -7 Left 1202484896 Y:25344073-25344095 CCGGCAGACCTAGTGCATGGCTC No data
Right 1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG No data
1202484890_1202484898 15 Left 1202484890 Y:25344051-25344073 CCCACAGCTGACTGCTGGGTCCC No data
Right 1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG No data
1202484891_1202484898 14 Left 1202484891 Y:25344052-25344074 CCACAGCTGACTGCTGGGTCCCC No data
Right 1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG No data
1202484894_1202484898 -5 Left 1202484894 Y:25344071-25344093 CCCCGGCAGACCTAGTGCATGGC No data
Right 1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG No data
1202484895_1202484898 -6 Left 1202484895 Y:25344072-25344094 CCCGGCAGACCTAGTGCATGGCT No data
Right 1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202484898 Original CRISPR ATGGCTCCACACTGCCATCT TGG Intergenic
No off target data available for this crispr