ID: 1202489358

View in Genome Browser
Species Human (GRCh38)
Location Y:25391455-25391477
Sequence ACTGCAGGTGAAACAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202489356_1202489358 -8 Left 1202489356 Y:25391440-25391462 CCTCATGGATCTTCAACTGCAGG No data
Right 1202489358 Y:25391455-25391477 ACTGCAGGTGAAACAGATGCTGG No data
1202489352_1202489358 26 Left 1202489352 Y:25391406-25391428 CCATGGGACTGATGACTGCATGA No data
Right 1202489358 Y:25391455-25391477 ACTGCAGGTGAAACAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202489358 Original CRISPR ACTGCAGGTGAAACAGATGC TGG Intergenic
No off target data available for this crispr