ID: 1202491617

View in Genome Browser
Species Human (GRCh38)
Location Y:25409019-25409041
Sequence GAGCTGTCCTGGTGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491617_1202491632 29 Left 1202491617 Y:25409019-25409041 CCTGCTGGGCACCAGGACAGCTC No data
Right 1202491632 Y:25409071-25409093 AGACAGAGTCAGGGAGATGGAGG No data
1202491617_1202491629 20 Left 1202491617 Y:25409019-25409041 CCTGCTGGGCACCAGGACAGCTC No data
Right 1202491629 Y:25409062-25409084 TCAGCCTTGAGACAGAGTCAGGG No data
1202491617_1202491628 19 Left 1202491617 Y:25409019-25409041 CCTGCTGGGCACCAGGACAGCTC No data
Right 1202491628 Y:25409061-25409083 CTCAGCCTTGAGACAGAGTCAGG No data
1202491617_1202491631 26 Left 1202491617 Y:25409019-25409041 CCTGCTGGGCACCAGGACAGCTC No data
Right 1202491631 Y:25409068-25409090 TTGAGACAGAGTCAGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491617 Original CRISPR GAGCTGTCCTGGTGCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr