ID: 1202491733

View in Genome Browser
Species Human (GRCh38)
Location Y:25409514-25409536
Sequence GGACCAGGCCAGCCTCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491733_1202491738 9 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491738 Y:25409546-25409568 TTCTACTCCCCTGAGTCATGTGG No data
1202491733_1202491743 21 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491743 Y:25409558-25409580 GAGTCATGTGGGCCTGCAGATGG No data
1202491733_1202491744 22 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491744 Y:25409559-25409581 AGTCATGTGGGCCTGCAGATGGG No data
1202491733_1202491739 10 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491739 Y:25409547-25409569 TCTACTCCCCTGAGTCATGTGGG No data
1202491733_1202491748 28 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491748 Y:25409565-25409587 GTGGGCCTGCAGATGGGGGTGGG No data
1202491733_1202491746 24 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491746 Y:25409561-25409583 TCATGTGGGCCTGCAGATGGGGG No data
1202491733_1202491750 30 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491733_1202491749 29 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491749 Y:25409566-25409588 TGGGCCTGCAGATGGGGGTGGGG No data
1202491733_1202491747 27 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491747 Y:25409564-25409586 TGTGGGCCTGCAGATGGGGGTGG No data
1202491733_1202491745 23 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491745 Y:25409560-25409582 GTCATGTGGGCCTGCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491733 Original CRISPR GGACCAGGCCAGCCTCCCTG CGG (reversed) Intergenic