ID: 1202491735

View in Genome Browser
Species Human (GRCh38)
Location Y:25409535-25409557
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491735_1202491752 22 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491752 Y:25409580-25409602 GGGGTGGGGGTCTCCCTTCCAGG No data
1202491735_1202491744 1 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491744 Y:25409559-25409581 AGTCATGTGGGCCTGCAGATGGG No data
1202491735_1202491743 0 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491743 Y:25409558-25409580 GAGTCATGTGGGCCTGCAGATGG No data
1202491735_1202491749 8 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491749 Y:25409566-25409588 TGGGCCTGCAGATGGGGGTGGGG No data
1202491735_1202491746 3 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491746 Y:25409561-25409583 TCATGTGGGCCTGCAGATGGGGG No data
1202491735_1202491750 9 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491735_1202491747 6 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491747 Y:25409564-25409586 TGTGGGCCTGCAGATGGGGGTGG No data
1202491735_1202491748 7 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491748 Y:25409565-25409587 GTGGGCCTGCAGATGGGGGTGGG No data
1202491735_1202491753 23 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491735_1202491745 2 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491745 Y:25409560-25409582 GTCATGTGGGCCTGCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491735 Original CRISPR AGGGGAGTAGAAGGAAGAAA GGG (reversed) Intergenic