ID: 1202491740

View in Genome Browser
Species Human (GRCh38)
Location Y:25409553-25409575
Sequence TGCAGGCCCACATGACTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491740_1202491755 16 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491740_1202491754 15 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491754 Y:25409591-25409613 CTCCCTTCCAGGGCCCTGAGTGG No data
1202491740_1202491750 -9 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491740_1202491759 25 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data
1202491740_1202491749 -10 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491749 Y:25409566-25409588 TGGGCCTGCAGATGGGGGTGGGG No data
1202491740_1202491752 4 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491752 Y:25409580-25409602 GGGGTGGGGGTCTCCCTTCCAGG No data
1202491740_1202491753 5 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491740 Original CRISPR TGCAGGCCCACATGACTCAG GGG (reversed) Intergenic