ID: 1202491741

View in Genome Browser
Species Human (GRCh38)
Location Y:25409554-25409576
Sequence CTGCAGGCCCACATGACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491741_1202491754 14 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491754 Y:25409591-25409613 CTCCCTTCCAGGGCCCTGAGTGG No data
1202491741_1202491759 24 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data
1202491741_1202491750 -10 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491741_1202491752 3 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491752 Y:25409580-25409602 GGGGTGGGGGTCTCCCTTCCAGG No data
1202491741_1202491755 15 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491741_1202491753 4 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491741 Original CRISPR CTGCAGGCCCACATGACTCA GGG (reversed) Intergenic