ID: 1202491742

View in Genome Browser
Species Human (GRCh38)
Location Y:25409555-25409577
Sequence TCTGCAGGCCCACATGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491742_1202491753 3 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491742_1202491754 13 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491754 Y:25409591-25409613 CTCCCTTCCAGGGCCCTGAGTGG No data
1202491742_1202491759 23 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data
1202491742_1202491752 2 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491752 Y:25409580-25409602 GGGGTGGGGGTCTCCCTTCCAGG No data
1202491742_1202491755 14 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491742 Original CRISPR TCTGCAGGCCCACATGACTC AGG (reversed) Intergenic