ID: 1202491750

View in Genome Browser
Species Human (GRCh38)
Location Y:25409567-25409589
Sequence GGGCCTGCAGATGGGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491737_1202491750 0 Left 1202491737 Y:25409544-25409566 CCTTCTACTCCCCTGAGTCATGT No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491740_1202491750 -9 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491736_1202491750 8 Left 1202491736 Y:25409536-25409558 CCTTTCTTCCTTCTACTCCCCTG No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491734_1202491750 15 Left 1202491734 Y:25409529-25409551 CCTGGTCCCTTTCTTCCTTCTAC No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491741_1202491750 -10 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491735_1202491750 9 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data
1202491733_1202491750 30 Left 1202491733 Y:25409514-25409536 CCGCAGGGAGGCTGGCCTGGTCC No data
Right 1202491750 Y:25409567-25409589 GGGCCTGCAGATGGGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491750 Original CRISPR GGGCCTGCAGATGGGGGTGG GGG Intergenic