ID: 1202491751

View in Genome Browser
Species Human (GRCh38)
Location Y:25409570-25409592
Sequence AGACCCCCACCCCCATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491751_1202491755 -1 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491751_1202491764 30 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491764 Y:25409623-25409645 GTGAAAGAGGAAAGTTGCTGTGG No data
1202491751_1202491762 17 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491762 Y:25409610-25409632 GTGGGCAGACCAGGTGAAAGAGG No data
1202491751_1202491754 -2 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491754 Y:25409591-25409613 CTCCCTTCCAGGGCCCTGAGTGG No data
1202491751_1202491759 8 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491751 Original CRISPR AGACCCCCACCCCCATCTGC AGG (reversed) Intergenic