ID: 1202491753

View in Genome Browser
Species Human (GRCh38)
Location Y:25409581-25409603
Sequence GGGTGGGGGTCTCCCTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491741_1202491753 4 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491742_1202491753 3 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491740_1202491753 5 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491735_1202491753 23 Left 1202491735 Y:25409535-25409557 CCCTTTCTTCCTTCTACTCCCCT No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491734_1202491753 29 Left 1202491734 Y:25409529-25409551 CCTGGTCCCTTTCTTCCTTCTAC No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491737_1202491753 14 Left 1202491737 Y:25409544-25409566 CCTTCTACTCCCCTGAGTCATGT No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data
1202491736_1202491753 22 Left 1202491736 Y:25409536-25409558 CCTTTCTTCCTTCTACTCCCCTG No data
Right 1202491753 Y:25409581-25409603 GGGTGGGGGTCTCCCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491753 Original CRISPR GGGTGGGGGTCTCCCTTCCA GGG Intergenic