ID: 1202491755

View in Genome Browser
Species Human (GRCh38)
Location Y:25409592-25409614
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491740_1202491755 16 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491741_1202491755 15 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491751_1202491755 -1 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491742_1202491755 14 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data
1202491737_1202491755 25 Left 1202491737 Y:25409544-25409566 CCTTCTACTCCCCTGAGTCATGT No data
Right 1202491755 Y:25409592-25409614 TCCCTTCCAGGGCCCTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491755 Original CRISPR TCCCTTCCAGGGCCCTGAGT GGG Intergenic