ID: 1202491759

View in Genome Browser
Species Human (GRCh38)
Location Y:25409601-25409623
Sequence GGGCCCTGAGTGGGCAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202491740_1202491759 25 Left 1202491740 Y:25409553-25409575 CCCCTGAGTCATGTGGGCCTGCA No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data
1202491751_1202491759 8 Left 1202491751 Y:25409570-25409592 CCTGCAGATGGGGGTGGGGGTCT No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data
1202491742_1202491759 23 Left 1202491742 Y:25409555-25409577 CCTGAGTCATGTGGGCCTGCAGA No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data
1202491741_1202491759 24 Left 1202491741 Y:25409554-25409576 CCCTGAGTCATGTGGGCCTGCAG No data
Right 1202491759 Y:25409601-25409623 GGGCCCTGAGTGGGCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202491759 Original CRISPR GGGCCCTGAGTGGGCAGACC AGG Intergenic