ID: 1202493260

View in Genome Browser
Species Human (GRCh38)
Location Y:25419480-25419502
Sequence GATGGCAGGATATGATAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202493260_1202493263 -10 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493263 Y:25419493-25419515 TCCTGCCATCTGGCCCCATATGG No data
1202493260_1202493267 2 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493267 Y:25419505-25419527 GCCCCATATGGAGTCCTACAGGG No data
1202493260_1202493273 18 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493273 Y:25419521-25419543 TACAGGGGACTCTCAGACCCAGG No data
1202493260_1202493269 3 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493269 Y:25419506-25419528 CCCCATATGGAGTCCTACAGGGG No data
1202493260_1202493266 1 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493266 Y:25419504-25419526 GGCCCCATATGGAGTCCTACAGG No data
1202493260_1202493274 30 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493274 Y:25419533-25419555 TCAGACCCAGGCGTGACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202493260 Original CRISPR GATGGCAGGATATGATAACA GGG (reversed) Intergenic