ID: 1202493261

View in Genome Browser
Species Human (GRCh38)
Location Y:25419481-25419503
Sequence AGATGGCAGGATATGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202493261_1202493269 2 Left 1202493261 Y:25419481-25419503 CCTGTTATCATATCCTGCCATCT No data
Right 1202493269 Y:25419506-25419528 CCCCATATGGAGTCCTACAGGGG No data
1202493261_1202493274 29 Left 1202493261 Y:25419481-25419503 CCTGTTATCATATCCTGCCATCT No data
Right 1202493274 Y:25419533-25419555 TCAGACCCAGGCGTGACCACTGG No data
1202493261_1202493267 1 Left 1202493261 Y:25419481-25419503 CCTGTTATCATATCCTGCCATCT No data
Right 1202493267 Y:25419505-25419527 GCCCCATATGGAGTCCTACAGGG No data
1202493261_1202493266 0 Left 1202493261 Y:25419481-25419503 CCTGTTATCATATCCTGCCATCT No data
Right 1202493266 Y:25419504-25419526 GGCCCCATATGGAGTCCTACAGG No data
1202493261_1202493273 17 Left 1202493261 Y:25419481-25419503 CCTGTTATCATATCCTGCCATCT No data
Right 1202493273 Y:25419521-25419543 TACAGGGGACTCTCAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202493261 Original CRISPR AGATGGCAGGATATGATAAC AGG (reversed) Intergenic