ID: 1202493266

View in Genome Browser
Species Human (GRCh38)
Location Y:25419504-25419526
Sequence GGCCCCATATGGAGTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202493261_1202493266 0 Left 1202493261 Y:25419481-25419503 CCTGTTATCATATCCTGCCATCT No data
Right 1202493266 Y:25419504-25419526 GGCCCCATATGGAGTCCTACAGG No data
1202493260_1202493266 1 Left 1202493260 Y:25419480-25419502 CCCTGTTATCATATCCTGCCATC No data
Right 1202493266 Y:25419504-25419526 GGCCCCATATGGAGTCCTACAGG No data
1202493259_1202493266 12 Left 1202493259 Y:25419469-25419491 CCTGACTTACACCCTGTTATCAT No data
Right 1202493266 Y:25419504-25419526 GGCCCCATATGGAGTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202493266 Original CRISPR GGCCCCATATGGAGTCCTAC AGG Intergenic