ID: 1202494566

View in Genome Browser
Species Human (GRCh38)
Location Y:25430094-25430116
Sequence CTGGTTTTCCGTGGTTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202494560_1202494566 3 Left 1202494560 Y:25430068-25430090 CCACCACACCTGGCCAACTTGTT No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data
1202494564_1202494566 -10 Left 1202494564 Y:25430081-25430103 CCAACTTGTTTTTCTGGTTTTCC No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data
1202494557_1202494566 22 Left 1202494557 Y:25430049-25430071 CCCAGATTGCAGGCATGAGCCAC No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data
1202494558_1202494566 21 Left 1202494558 Y:25430050-25430072 CCAGATTGCAGGCATGAGCCACC No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data
1202494556_1202494566 30 Left 1202494556 Y:25430041-25430063 CCAAAGTGCCCAGATTGCAGGCA No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data
1202494561_1202494566 0 Left 1202494561 Y:25430071-25430093 CCACACCTGGCCAACTTGTTTTT No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data
1202494563_1202494566 -5 Left 1202494563 Y:25430076-25430098 CCTGGCCAACTTGTTTTTCTGGT No data
Right 1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202494566 Original CRISPR CTGGTTTTCCGTGGTTTTCA TGG Intergenic
No off target data available for this crispr