ID: 1202496618

View in Genome Browser
Species Human (GRCh38)
Location Y:25451930-25451952
Sequence TTGCCCTTGCCAATCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202496612_1202496618 4 Left 1202496612 Y:25451903-25451925 CCACCCCTTCAGCAAGCCACTCA No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496613_1202496618 1 Left 1202496613 Y:25451906-25451928 CCCCTTCAGCAAGCCACTCAGTC No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496610_1202496618 6 Left 1202496610 Y:25451901-25451923 CCCCACCCCTTCAGCAAGCCACT No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496607_1202496618 29 Left 1202496607 Y:25451878-25451900 CCCACCAAAGTCTTCTCAGTCAG No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496615_1202496618 -1 Left 1202496615 Y:25451908-25451930 CCTTCAGCAAGCCACTCAGTCCT No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496609_1202496618 25 Left 1202496609 Y:25451882-25451904 CCAAAGTCTTCTCAGTCAGCCCC No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496608_1202496618 28 Left 1202496608 Y:25451879-25451901 CCACCAAAGTCTTCTCAGTCAGC No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496611_1202496618 5 Left 1202496611 Y:25451902-25451924 CCCACCCCTTCAGCAAGCCACTC No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496614_1202496618 0 Left 1202496614 Y:25451907-25451929 CCCTTCAGCAAGCCACTCAGTCC No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data
1202496606_1202496618 30 Left 1202496606 Y:25451877-25451899 CCCCACCAAAGTCTTCTCAGTCA No data
Right 1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202496618 Original CRISPR TTGCCCTTGCCAATCACCAC AGG Intergenic
No off target data available for this crispr