ID: 1202500532

View in Genome Browser
Species Human (GRCh38)
Location Y:25478798-25478820
Sequence AGGGGGCCTTGCCCAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202500532_1202500547 11 Left 1202500532 Y:25478798-25478820 CCTCCTCCTGGGCAAGGCCCCCT No data
Right 1202500547 Y:25478832-25478854 ATGACCCCTGTGCTTCCCGGTGG No data
1202500532_1202500545 8 Left 1202500532 Y:25478798-25478820 CCTCCTCCTGGGCAAGGCCCCCT No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202500532 Original CRISPR AGGGGGCCTTGCCCAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr