ID: 1202500545

View in Genome Browser
Species Human (GRCh38)
Location Y:25478829-25478851
Sequence CCCATGACCCCTGTGCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202500531_1202500545 9 Left 1202500531 Y:25478797-25478819 CCCTCCTCCTGGGCAAGGCCCCC No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data
1202500538_1202500545 -10 Left 1202500538 Y:25478816-25478838 CCCCTCCTGGGCCCCCATGACCC No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data
1202500533_1202500545 5 Left 1202500533 Y:25478801-25478823 CCTCCTGGGCAAGGCCCCCTCCT No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data
1202500537_1202500545 -9 Left 1202500537 Y:25478815-25478837 CCCCCTCCTGGGCCCCCATGACC No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data
1202500535_1202500545 2 Left 1202500535 Y:25478804-25478826 CCTGGGCAAGGCCCCCTCCTGGG No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data
1202500532_1202500545 8 Left 1202500532 Y:25478798-25478820 CCTCCTCCTGGGCAAGGCCCCCT No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data
1202500530_1202500545 10 Left 1202500530 Y:25478796-25478818 CCCCTCCTCCTGGGCAAGGCCCC No data
Right 1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202500545 Original CRISPR CCCATGACCCCTGTGCTTCC CGG Intergenic
No off target data available for this crispr