ID: 1202501291

View in Genome Browser
Species Human (GRCh38)
Location Y:25482774-25482796
Sequence CAGTGGTGATGTGGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202501281_1202501291 28 Left 1202501281 Y:25482723-25482745 CCAAGATCACGGAAGATGATATG No data
Right 1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG No data
1202501285_1202501291 -8 Left 1202501285 Y:25482759-25482781 CCACCAGGACCAGAGCAGTGGTG No data
Right 1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG No data
1202501283_1202501291 5 Left 1202501283 Y:25482746-25482768 CCATTTGCTGCTGCCACCAGGAC No data
Right 1202501291 Y:25482774-25482796 CAGTGGTGATGTGGCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202501291 Original CRISPR CAGTGGTGATGTGGCCTGGG AGG Intergenic
No off target data available for this crispr