ID: 1202501805

View in Genome Browser
Species Human (GRCh38)
Location Y:25485326-25485348
Sequence GACCCCTCTGGAGGTACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202501805_1202501810 0 Left 1202501805 Y:25485326-25485348 CCTCAAGTACCTCCAGAGGGGTC No data
Right 1202501810 Y:25485349-25485371 CCACTGCCAGCCCTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202501805 Original CRISPR GACCCCTCTGGAGGTACTTG AGG (reversed) Intergenic
No off target data available for this crispr