ID: 1202502840

View in Genome Browser
Species Human (GRCh38)
Location Y:25490492-25490514
Sequence TGGCGTCTCTCATGGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202502840_1202502846 -7 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502846 Y:25490508-25490530 GACGCCAGCGTGTGTGGGGTGGG No data
1202502840_1202502847 -6 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502847 Y:25490509-25490531 ACGCCAGCGTGTGTGGGGTGGGG No data
1202502840_1202502849 -3 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502849 Y:25490512-25490534 CCAGCGTGTGTGGGGTGGGGAGG No data
1202502840_1202502850 -2 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502850 Y:25490513-25490535 CAGCGTGTGTGGGGTGGGGAGGG No data
1202502840_1202502851 15 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502851 Y:25490530-25490552 GGAGGGCCGCCGCAGTCCCCAGG No data
1202502840_1202502845 -8 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502845 Y:25490507-25490529 AGACGCCAGCGTGTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202502840 Original CRISPR TGGCGTCTCTCATGGCACCC AGG (reversed) Intergenic
No off target data available for this crispr