ID: 1202502846

View in Genome Browser
Species Human (GRCh38)
Location Y:25490508-25490530
Sequence GACGCCAGCGTGTGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202502840_1202502846 -7 Left 1202502840 Y:25490492-25490514 CCTGGGTGCCATGAGAGACGCCA No data
Right 1202502846 Y:25490508-25490530 GACGCCAGCGTGTGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202502846 Original CRISPR GACGCCAGCGTGTGTGGGGT GGG Intergenic
No off target data available for this crispr