ID: 1202502961

View in Genome Browser
Species Human (GRCh38)
Location Y:25491146-25491168
Sequence GCTGTGCTTGCGGAGTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202502956_1202502961 9 Left 1202502956 Y:25491114-25491136 CCTCAGCTCTAGCACTGGGAATC No data
Right 1202502961 Y:25491146-25491168 GCTGTGCTTGCGGAGTCTTGTGG No data
1202502953_1202502961 16 Left 1202502953 Y:25491107-25491129 CCAACTGCCTCAGCTCTAGCACT No data
Right 1202502961 Y:25491146-25491168 GCTGTGCTTGCGGAGTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202502961 Original CRISPR GCTGTGCTTGCGGAGTCTTG TGG Intergenic
No off target data available for this crispr