ID: 1202503493

View in Genome Browser
Species Human (GRCh38)
Location Y:25496012-25496034
Sequence CCCTGATCCCACAGGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202503493_1202503501 26 Left 1202503493 Y:25496012-25496034 CCCAAGCTCCTGTGGGATCAGGG No data
Right 1202503501 Y:25496061-25496083 TCTTGCTGCTGCCGCAGACTTGG No data
1202503493_1202503500 3 Left 1202503493 Y:25496012-25496034 CCCAAGCTCCTGTGGGATCAGGG No data
Right 1202503500 Y:25496038-25496060 CTAGAGCGGTACACAGGTACTGG No data
1202503493_1202503498 -3 Left 1202503493 Y:25496012-25496034 CCCAAGCTCCTGTGGGATCAGGG No data
Right 1202503498 Y:25496032-25496054 GGGCTCCTAGAGCGGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202503493 Original CRISPR CCCTGATCCCACAGGAGCTT GGG (reversed) Intergenic