ID: 1202509289

View in Genome Browser
Species Human (GRCh38)
Location Y:25554932-25554954
Sequence CAGAGTCTACAGAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6396
Summary {0: 9, 1: 32, 2: 1201, 3: 3720, 4: 1434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202509289_1202509299 9 Left 1202509289 Y:25554932-25554954 CCTGCCTGCCTCTGTAGACTCTG 0: 9
1: 32
2: 1201
3: 3720
4: 1434
Right 1202509299 Y:25554964-25554986 GCAGGGCATAGCCAAACAAAAGG 0: 488
1: 484
2: 1197
3: 875
4: 503
1202509289_1202509296 -9 Left 1202509289 Y:25554932-25554954 CCTGCCTGCCTCTGTAGACTCTG 0: 9
1: 32
2: 1201
3: 3720
4: 1434
Right 1202509296 Y:25554946-25554968 TAGACTCTGCCTGTGGGGGCAGG No data
1202509289_1202509297 -8 Left 1202509289 Y:25554932-25554954 CCTGCCTGCCTCTGTAGACTCTG 0: 9
1: 32
2: 1201
3: 3720
4: 1434
Right 1202509297 Y:25554947-25554969 AGACTCTGCCTGTGGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202509289 Original CRISPR CAGAGTCTACAGAGGCAGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr