ID: 1202512450

View in Genome Browser
Species Human (GRCh38)
Location Y:25594862-25594884
Sequence GTGGAGAGACGGCTTTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202512446_1202512450 14 Left 1202512446 Y:25594825-25594847 CCACAGGCTGGATGTTCTGATGA No data
Right 1202512450 Y:25594862-25594884 GTGGAGAGACGGCTTTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202512450 Original CRISPR GTGGAGAGACGGCTTTAGAG TGG Intergenic
No off target data available for this crispr