ID: 1202512761

View in Genome Browser
Species Human (GRCh38)
Location Y:25597608-25597630
Sequence AGTTATCTGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202512761_1202512767 22 Left 1202512761 Y:25597608-25597630 CCTGCCATTTTCTGCAGATAACT No data
Right 1202512767 Y:25597653-25597675 CTTGGCCCATTGCTGGGCTTTGG No data
1202512761_1202512764 4 Left 1202512761 Y:25597608-25597630 CCTGCCATTTTCTGCAGATAACT No data
Right 1202512764 Y:25597635-25597657 TTCTTTGGAGAGACAGCTCTTGG No data
1202512761_1202512765 15 Left 1202512761 Y:25597608-25597630 CCTGCCATTTTCTGCAGATAACT No data
Right 1202512765 Y:25597646-25597668 GACAGCTCTTGGCCCATTGCTGG No data
1202512761_1202512766 16 Left 1202512761 Y:25597608-25597630 CCTGCCATTTTCTGCAGATAACT No data
Right 1202512766 Y:25597647-25597669 ACAGCTCTTGGCCCATTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202512761 Original CRISPR AGTTATCTGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr