ID: 1202512765

View in Genome Browser
Species Human (GRCh38)
Location Y:25597646-25597668
Sequence GACAGCTCTTGGCCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202512761_1202512765 15 Left 1202512761 Y:25597608-25597630 CCTGCCATTTTCTGCAGATAACT No data
Right 1202512765 Y:25597646-25597668 GACAGCTCTTGGCCCATTGCTGG No data
1202512760_1202512765 16 Left 1202512760 Y:25597607-25597629 CCCTGCCATTTTCTGCAGATAAC 0: 12
1: 195
2: 171
3: 143
4: 299
Right 1202512765 Y:25597646-25597668 GACAGCTCTTGGCCCATTGCTGG No data
1202512762_1202512765 11 Left 1202512762 Y:25597612-25597634 CCATTTTCTGCAGATAACTAGTA No data
Right 1202512765 Y:25597646-25597668 GACAGCTCTTGGCCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202512765 Original CRISPR GACAGCTCTTGGCCCATTGC TGG Intergenic
No off target data available for this crispr