ID: 1202521086

View in Genome Browser
Species Human (GRCh38)
Location Y:25695429-25695451
Sequence GCTCAGAGCAGACATTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202521084_1202521086 27 Left 1202521084 Y:25695379-25695401 CCTCATCTGTGACAGACAAAACA No data
Right 1202521086 Y:25695429-25695451 GCTCAGAGCAGACATTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202521086 Original CRISPR GCTCAGAGCAGACATTCAGC AGG Intergenic
No off target data available for this crispr