ID: 1202521304

View in Genome Browser
Species Human (GRCh38)
Location Y:25697672-25697694
Sequence CACTTGTCCCAGAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202521304_1202521309 18 Left 1202521304 Y:25697672-25697694 CCTCAGGGCCTCTGGGACAAGTG No data
Right 1202521309 Y:25697713-25697735 AAGGACCCTATTTAAAGCAATGG No data
1202521304_1202521307 -1 Left 1202521304 Y:25697672-25697694 CCTCAGGGCCTCTGGGACAAGTG No data
Right 1202521307 Y:25697694-25697716 GTTCCTTGGAGATTCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202521304 Original CRISPR CACTTGTCCCAGAGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr