ID: 1202531103

View in Genome Browser
Species Human (GRCh38)
Location Y:25820271-25820293
Sequence CAAGCTGATAAAATTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202531103_1202531109 28 Left 1202531103 Y:25820271-25820293 CCAATAGCAATTTTATCAGCTTG No data
Right 1202531109 Y:25820322-25820344 AACTTCACTGTTGCCCCTGCAGG 0: 3
1: 3
2: 0
3: 26
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202531103 Original CRISPR CAAGCTGATAAAATTGCTAT TGG (reversed) Intergenic
No off target data available for this crispr