ID: 1202531109

View in Genome Browser
Species Human (GRCh38)
Location Y:25820322-25820344
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 3, 1: 3, 2: 0, 3: 26, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202531104_1202531109 -6 Left 1202531104 Y:25820305-25820327 CCACTAAAGAAACCCCCAACTTC No data
Right 1202531109 Y:25820322-25820344 AACTTCACTGTTGCCCCTGCAGG 0: 3
1: 3
2: 0
3: 26
4: 258
1202531103_1202531109 28 Left 1202531103 Y:25820271-25820293 CCAATAGCAATTTTATCAGCTTG No data
Right 1202531109 Y:25820322-25820344 AACTTCACTGTTGCCCCTGCAGG 0: 3
1: 3
2: 0
3: 26
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202531109 Original CRISPR AACTTCACTGTTGCCCCTGC AGG Intergenic
901707077 1:11082050-11082072 AGTTTCACTGTTGCCCAGGCTGG - Intronic
902243224 1:15102381-15102403 CACCACACTGTTGCCTCTGCTGG - Intronic
902553091 1:17230723-17230745 GACTTCACTGGTGCGCCTCCAGG - Intronic
902583997 1:17426790-17426812 AGTTTCACTGTTGCCCAGGCTGG + Intronic
903013263 1:20345067-20345089 AACTTCACAGGTGCCCTGGCTGG - Intronic
904788529 1:33000216-33000238 AGCCTCACTGTTGCCCAGGCTGG - Intergenic
906332470 1:44898259-44898281 AACTTCACTGTTGTCAGTGAAGG - Intronic
908290769 1:62665014-62665036 AGTCTCACTGTTGCCCATGCTGG + Intronic
910183485 1:84510135-84510157 GGCTTCTCTGTTGCCCATGCTGG - Intergenic
912601843 1:110943751-110943773 AAGTTTGCTGTTTCCCCTGCTGG + Intergenic
912824437 1:112892826-112892848 AACCTCGCTGTTGCCCAGGCTGG - Intergenic
913335625 1:117706966-117706988 AATGTCACTGGTGCCCCTGTTGG - Intergenic
913966958 1:143384460-143384482 AGCTTCACTGTTGCCCAGGCTGG + Intergenic
914061334 1:144210067-144210089 AGCTTCACTGTTGCCCAGGCTGG + Intergenic
914117816 1:144756302-144756324 AGCTTCACTGTTGCCCAGGCTGG - Intergenic
914904552 1:151733088-151733110 AATCTCACTGTTGCCCAGGCTGG - Intergenic
915403510 1:155641745-155641767 AACTTCGCTGTTGCCTTTGCAGG - Intergenic
915963597 1:160287066-160287088 AGTTTCACTGTTGCCCAGGCTGG + Intergenic
917012480 1:170489545-170489567 AGTTTCACTGTTGCCCAGGCTGG - Intergenic
917062477 1:171055961-171055983 AAAATCACCGTTCCCCCTGCTGG - Intronic
918187799 1:182143379-182143401 AACTTCAGCGGTGGCCCTGCAGG + Intergenic
919392485 1:197004735-197004757 TACGTCACTGTTGACCCTGGAGG - Exonic
919980157 1:202637892-202637914 AATGTCACTGTGGCCCCTTCAGG + Intronic
920458753 1:206120768-206120790 AACTTCATTTTTTCCCCAGCAGG + Intergenic
922635050 1:227159871-227159893 GACTTCACTGTTGCCCAGGCTGG + Intronic
922954903 1:229591050-229591072 AATCTCGCTGTTGCCCATGCTGG + Intergenic
924216049 1:241823807-241823829 ATCTTCACTGTAGCCACTTCTGG + Intergenic
1064039485 10:11947170-11947192 GCCTTCACTGTCGCCCATGCTGG - Intronic
1064091289 10:12387897-12387919 AATTTCCCTTTCGCCCCTGCTGG + Intronic
1064228494 10:13508209-13508231 AACATGGCTGTTGTCCCTGCAGG - Intronic
1065281413 10:24142784-24142806 AACATCACTGTTGTCCCTGTAGG + Intronic
1065938492 10:30543006-30543028 AAACTCTCTGTAGCCCCTGCTGG + Intergenic
1067060877 10:43077355-43077377 AACTTCGCCCTGGCCCCTGCGGG - Intronic
1067300314 10:45001521-45001543 AACTTCGTGCTTGCCCCTGCTGG + Intronic
1068170697 10:53390008-53390030 ACCTTCACTATTGCTCTTGCTGG - Intergenic
1069001431 10:63271201-63271223 AATCTCACTGTTGCCCAGGCTGG + Intronic
1069746535 10:70718415-70718437 AGTTTCACTGTTGCCCAGGCTGG + Intronic
1070903676 10:80053004-80053026 AATCTCACTGTTGCCCAGGCTGG + Intergenic
1070940813 10:80345148-80345170 AAGGTCACTGTTGACACTGCTGG - Intronic
1072144804 10:92625374-92625396 AGTTTCACTGTTGCCCAGGCTGG + Intronic
1072323426 10:94273003-94273025 AACTCCATTGTTGCCCAGGCTGG - Intronic
1072339074 10:94428738-94428760 AATCTCACTGTTGCCCAGGCTGG + Intronic
1072450495 10:95535790-95535812 AATTTCATTCTTACCCCTGCTGG - Intronic
1073231461 10:101974593-101974615 AAAGTCACTGCTACCCCTGCAGG - Intronic
1073446978 10:103587019-103587041 AATCTCACTGTTGCCCAAGCTGG - Intronic
1074780017 10:116795654-116795676 AATCTCACTGTTGCCCATGCTGG - Intergenic
1075967748 10:126627387-126627409 AACTTCACTGTGGTCCATGCGGG + Intronic
1076271650 10:129157560-129157582 AACTACACTGTTGGCGCTCCAGG + Intergenic
1078274832 11:9833798-9833820 AGTTTCACTGTTGCCCAGGCTGG + Intronic
1078947268 11:16083219-16083241 AATTTGACTCTTGCCCCTGAAGG - Intronic
1082929940 11:58592110-58592132 AATTTCACTCTTGCCCAGGCTGG + Intronic
1084053336 11:66615618-66615640 AATCTCACTGTCGCCCATGCTGG + Intergenic
1085218325 11:74851464-74851486 AACTTCACTGGTGTCACTCCAGG + Intronic
1085220714 11:74871701-74871723 AGCTTCACTCTTACCCCTGCAGG + Intronic
1086304502 11:85465042-85465064 TTCTGCACTGTTGCCCGTGCTGG - Intronic
1088615395 11:111621942-111621964 TACTTCTCTTTTGCCCCTCCTGG + Intronic
1089251787 11:117168818-117168840 AGTTTCACTGTTGCCCAGGCTGG + Exonic
1089527256 11:119105608-119105630 AAAGTCACTGTTGCCCAGGCTGG - Intronic
1089645375 11:119875485-119875507 AACTTCACTGAAGCCCATCCTGG + Intergenic
1091511285 12:1129275-1129297 AGTCTCACTGTTGCCCCGGCTGG - Intronic
1092190832 12:6519376-6519398 AATCTCACTGTTGCCCAGGCTGG + Intronic
1092779566 12:11972904-11972926 AAATGCAATGTTGACCCTGCAGG + Intergenic
1093484618 12:19639950-19639972 TAATTCACTGCTGCACCTGCTGG + Intronic
1093595307 12:20951802-20951824 AATTTCACTCTTACCCCTACAGG - Intergenic
1093939450 12:25037326-25037348 AATCTCACTGTTGCCCAAGCTGG + Intronic
1094201841 12:27803165-27803187 GATTTCACTGTTGCCCAGGCTGG - Intergenic
1094757268 12:33485971-33485993 CACTTCTCTGGTGGCCCTGCAGG - Intergenic
1095126437 12:38483734-38483756 AATTTTACTCTTGCCTCTGCTGG - Intergenic
1096527130 12:52217011-52217033 CCCTTCACTGTTTCCCCAGCAGG - Intergenic
1100750057 12:97688677-97688699 AACTTTTCTGTTGTTCCTGCAGG - Intergenic
1101874496 12:108589553-108589575 CACCTCTCTGTTTCCCCTGCAGG - Intergenic
1102102996 12:110295190-110295212 AGCTTCACTCTTGCCCAGGCTGG + Intronic
1104199468 12:126574448-126574470 AGCCTCACTGTTGCCCAGGCTGG + Intergenic
1104875470 12:132031168-132031190 AACCTCACTGTTGACCATGAAGG - Intronic
1104955676 12:132464822-132464844 AACTTCTCCCTTGCCCTTGCCGG + Intergenic
1105586383 13:21748346-21748368 GAGTTCACTGCTGCCCCTGAGGG - Intergenic
1108533086 13:51345563-51345585 AATCTCACTGTTGCCCAAGCTGG - Intronic
1108652676 13:52497005-52497027 AACTCAACTGTTGCTCCGGCAGG - Intergenic
1112350369 13:98628193-98628215 CACTGCACTGTTGCCCAGGCTGG + Intergenic
1114632320 14:24167035-24167057 AATTTCACTGTCACCCCAGCAGG + Exonic
1115488937 14:33940192-33940214 AAAATCTCTGTAGCCCCTGCAGG + Intronic
1116660981 14:47709920-47709942 CACTTCACTGCTGCCCCTCCAGG - Intergenic
1116927877 14:50659649-50659671 AATTTCAGTGTTGCCCAGGCTGG - Intronic
1118624951 14:67650169-67650191 AACTTCATTCTCACCCCTGCAGG - Exonic
1119620859 14:76131081-76131103 AACATCCCTCTGGCCCCTGCAGG + Intergenic
1121271647 14:92641723-92641745 AACTTGAGTGTGGCCCTTGCGGG + Intronic
1122045182 14:99017877-99017899 AGATTCCCTGTTGCCCTTGCTGG - Intergenic
1123027253 14:105431962-105431984 AAGTTCACTGTTGACACTACTGG - Intronic
1123438108 15:20270455-20270477 AGTTTCACTGTTGCCCAGGCTGG + Intergenic
1123674683 15:22698452-22698474 AATCGCTCTGTTGCCCCTGCTGG - Intergenic
1123768935 15:23509846-23509868 AATTCTGCTGTTGCCCCTGCAGG - Intergenic
1124326696 15:28771433-28771455 AATCGCTCTGTTGCCCCTGCTGG - Intergenic
1124495770 15:30185937-30185959 AATGTCACTGTGGCCCCTTCAGG + Intergenic
1124747803 15:32352709-32352731 AATGTCACTGTGGCCCCTTCAGG - Intergenic
1125350270 15:38759596-38759618 AACTACAATATTGCCACTGCAGG + Intergenic
1125988428 15:44079499-44079521 AAGTTCAATGTTGCCCAGGCTGG - Intronic
1126527666 15:49675319-49675341 AACTCCTTTTTTGCCCCTGCTGG - Intergenic
1128222915 15:65981628-65981650 AACTTCAATCTTGCCTCTGAGGG + Intronic
1130196795 15:81787019-81787041 AATTTCCCAGTTGCCCTTGCTGG - Intergenic
1131671182 15:94620938-94620960 CACTTCTCTGTTGCCCAGGCCGG + Intergenic
1135286962 16:21201741-21201763 AACTTCACTGAGGCCACTGGAGG + Exonic
1136846471 16:33580402-33580424 AGTTTCACTGTTGCCCAGGCTGG - Intergenic
1138807895 16:60112819-60112841 AACCTCACACTTGCCCCTGGTGG - Intergenic
1139783974 16:69375501-69375523 GATCTCACTGTTGCCCATGCTGG - Intronic
1139924819 16:70480287-70480309 AAAGTCACTTTTGCTCCTGCTGG + Intergenic
1140198840 16:72878339-72878361 CACTTCACTGGTGCCAGTGCCGG + Intronic
1141776512 16:86126695-86126717 AGTTTCACTGTTGCCCAGGCTGG - Intergenic
1141891848 16:86931201-86931223 AGCTTCAGTGTTGGCTCTGCTGG - Intergenic
1203108179 16_KI270728v1_random:1429057-1429079 AGTTTCACTGTTGCCCAGGCTGG - Intergenic
1142659335 17:1416940-1416962 AAACTCACTGTTGCCCAGGCTGG - Intergenic
1142706300 17:1696982-1697004 GACTCCACTGTTGCCCAGGCTGG + Intergenic
1144256220 17:13471015-13471037 ATCTTCCCTGTTGCCCAGGCTGG + Intergenic
1146741494 17:35288078-35288100 AACTGCTCTGTTGCCCAGGCTGG - Intergenic
1147218713 17:38915641-38915663 ACCTTCTCTGTGTCCCCTGCTGG + Intronic
1148397988 17:47325208-47325230 AGTTTCACTGTTGCCCAGGCTGG + Intronic
1148682102 17:49480162-49480184 AACTTCACTCTCGCCCAGGCTGG + Intergenic
1149660625 17:58332435-58332457 ACCTTCACTGCTGCCCCAACTGG - Intergenic
1152358836 17:79820666-79820688 AGTTTCACTGTTGCCCAGGCTGG + Intergenic
1153920078 18:9781344-9781366 GTCTTCTCTGTTGCCCATGCTGG + Intronic
1156234791 18:35191958-35191980 AATTTCACTGTTTCCCAGGCTGG - Intergenic
1156526992 18:37777102-37777124 AACTTCACTGTTCCTTCAGCAGG - Intergenic
1160506018 18:79427308-79427330 AAGTTCACTGTTGCACATGCTGG - Intronic
1160602179 18:80022189-80022211 AACTTCACTGTTGCCCCTGCAGG - Intronic
1160993215 19:1869634-1869656 GATTTCACTGTTGCCCAGGCTGG + Intergenic
1162640158 19:12002254-12002276 AGTTTCACTGTTGCCCAGGCTGG + Intergenic
1163222140 19:15929364-15929386 AGCTTCTGTGTGGCCCCTGCAGG - Intronic
1165558777 19:36660177-36660199 AATATCACTGTTGCCCAAGCTGG + Intronic
1166625525 19:44350249-44350271 AAGTTCACTGTTGCCACTAGTGG - Intronic
1167310214 19:48733218-48733240 GATTTCACTGTTGCCCAGGCTGG + Intronic
1167422238 19:49410966-49410988 CGCTTCTCTGTTGCCCCGGCTGG + Intronic
1167426644 19:49433021-49433043 AACTACACTGTGGTCCCTGAAGG - Intronic
1167660847 19:50795041-50795063 AGCTCCAGTGGTGCCCCTGCTGG + Exonic
1168582322 19:57565937-57565959 AACTTCACTGTTGACCCTGCAGG - Intergenic
1202700742 1_KI270712v1_random:161955-161977 AGCTTCACTGTTGCCCAGGCTGG + Intergenic
927806209 2:26149042-26149064 GACTTCACTGTTGCCTCAGCTGG - Intergenic
928482135 2:31693576-31693598 AGCTTCACTCTTACCCCTACAGG - Intergenic
929512652 2:42576865-42576887 AGTTTCACTGTTGCCCAGGCTGG - Intronic
929937177 2:46301545-46301567 AATTTCACTCTTGCCCAGGCTGG - Intronic
932818120 2:74877812-74877834 ATCCTCACTCTTGCCCCTGCTGG - Intronic
934171671 2:89545444-89545466 AGCTTCACTGTTGCCCAGGCTGG + Intergenic
934281980 2:91619762-91619784 AGCTTCACTGTTGCCCAGGCTGG + Intergenic
935348761 2:102135207-102135229 AACCACAGTGTTGCCTCTGCTGG + Intronic
936473042 2:112815764-112815786 AGTCTCACTGTTGCCCATGCTGG - Intergenic
936791323 2:116156978-116157000 AACTTCCTTATTGCCACTGCAGG + Intergenic
937088131 2:119185607-119185629 AGTTTCACTGTTGCCCAGGCTGG - Intergenic
939950802 2:148469769-148469791 TCCTTCAGTGTTGCCACTGCCGG - Exonic
941469724 2:165869847-165869869 AATCTCACTGTTGCCCAGGCTGG + Intronic
941926404 2:170899654-170899676 AGTTTCACTGTTGCCCAGGCTGG + Intergenic
942545770 2:177062224-177062246 GATTTCACTGTTGCCCATGCTGG + Intergenic
942935085 2:181546196-181546218 AATTCCACTGTTGACTCTGCAGG - Intronic
943938008 2:193949456-193949478 AACTGCAGTGTTGCCACTTCTGG - Intergenic
944450257 2:199835146-199835168 AACTTGCCTGTTGCCCAGGCTGG - Intronic
944606578 2:201356897-201356919 AACTTCTCTGAAGCCTCTGCCGG - Intronic
1168944184 20:1737841-1737863 AATCTCACTGTTGCCCAGGCTGG - Intergenic
1169129920 20:3161061-3161083 AGTCTCACTGTTGCCCCGGCTGG - Intergenic
1169812108 20:9618950-9618972 AATCTCACTGTTGCCCAGGCTGG + Intronic
1169845562 20:9987771-9987793 AATCTCACTGTTGCCCAGGCTGG - Intronic
1170177797 20:13492039-13492061 AACTTCACTTTTTCCCCTCTGGG - Intronic
1173447389 20:43131325-43131347 ACCTCCACTCTTGTCCCTGCTGG + Intronic
1173753766 20:45497195-45497217 TTCTTCACTTTTGCTCCTGCTGG + Intergenic
1174644668 20:52075191-52075213 AGCCTCACTGTTGCCCAGGCTGG - Intronic
1175918214 20:62437446-62437468 AACTTCAATAGTGCCCCCGCAGG + Intergenic
1178032542 21:28544516-28544538 GACTTCTCTGTCGCCCATGCTGG + Intergenic
1179569707 21:42271234-42271256 AGCTCCACTGTTCCCACTGCTGG - Intronic
1179664052 21:42897704-42897726 TCCTGCTCTGTTGCCCCTGCTGG + Intronic
1180864501 22:19108543-19108565 AAATTCTCTGTTGCCCAGGCTGG - Intronic
1181446206 22:22976806-22976828 ACCTTCACTCTTACCCCTACAGG + Intergenic
1182867855 22:33620146-33620168 AACTTCACTTGTGCCCCTGAAGG - Intronic
1184174781 22:42782218-42782240 AGTTTCACTGTTGCCCAGGCTGG + Intergenic
1185230487 22:49677624-49677646 GTCTCCACTGATGCCCCTGCAGG - Intergenic
949615065 3:5744548-5744570 AACTTCACCGTTGGCTCTACTGG + Intergenic
949731922 3:7123587-7123609 AGCTTCACTCTTGCCCAGGCTGG - Intronic
950119768 3:10474084-10474106 AACACCACTGCTGCCCCTGCAGG - Intronic
952178961 3:30897636-30897658 AAAATGACTGTGGCCCCTGCAGG - Intergenic
952278605 3:31901998-31902020 AGCCTCACTGTTGCCCAGGCTGG - Intronic
953658746 3:44874754-44874776 AACTGCTCTCTTGCCTCTGCCGG + Intronic
953663004 3:44904709-44904731 AATCTCACTGTTGCCCAGGCTGG + Intronic
954169524 3:48789682-48789704 AATTTCACTGTTGGCCAGGCTGG + Intronic
954425436 3:50440603-50440625 ACCTCCACTGTAGCCCGTGCAGG - Intronic
954558475 3:51536855-51536877 AGCCTCACTGTTGCCCAGGCTGG + Intergenic
954616094 3:51969422-51969444 GGCTTCACTGGAGCCCCTGCAGG + Exonic
954820139 3:53318991-53319013 AACTTTACTGTTGGACCTGTAGG - Intronic
955037156 3:55280094-55280116 CACTTCAGTGTTTCCCCAGCTGG + Intergenic
957502381 3:81073743-81073765 AACTTAAATGTTGCCACTGTTGG - Intergenic
958892469 3:99795783-99795805 AACTTCACTGGGGCCCCCACCGG - Exonic
960375757 3:116899581-116899603 AACTTCACTGTAGCCTCCTCGGG - Intronic
960819356 3:121711162-121711184 AGTTTCACTGTTGCCCATGCTGG - Intronic
961055939 3:123789075-123789097 AGCTGCTCTGTTGCCCATGCTGG - Intronic
964295128 3:155225260-155225282 AACTTAGCTTTTCCCCCTGCTGG - Intergenic
964317183 3:155457147-155457169 TTCTACACTGTGGCCCCTGCTGG + Intronic
965004539 3:163002514-163002536 AACTTAACTGCTGCCCCTTCAGG - Intergenic
966480489 3:180403002-180403024 AACTACACTGTTGGCTCTCCTGG + Intergenic
967119139 3:186367196-186367218 CTCTTCACTGTTGTCCCTGGAGG + Intergenic
969837155 4:9851093-9851115 CACTGCACTGTTGCAGCTGCTGG + Intronic
970728051 4:19070495-19070517 AATTTCACTGTCACCCCGGCTGG + Intergenic
973584588 4:52377506-52377528 AAAATCACTGTTTCCCCAGCCGG - Intergenic
975678343 4:76850454-76850476 AACTCCATTGTTGCCCAGGCTGG + Intergenic
977083530 4:92564350-92564372 AAAATCATTGTTGCCCCTGAGGG + Intronic
978391455 4:108230644-108230666 AATTTCGCTCTTGCCCATGCTGG + Intergenic
981541808 4:145853933-145853955 AATTGCTCTGTTGCCCATGCCGG - Intronic
981857537 4:149312235-149312257 CACTTCACTGTTGCCCCTCTTGG + Intergenic
982036938 4:151355024-151355046 AATCTCACTGTTGCCCAGGCTGG - Intergenic
984217346 4:176930842-176930864 ATCTTCACTGCTGGCCCTGCTGG - Intergenic
984676961 4:182560475-182560497 AGCTTCACTGTTGCTTCTGCTGG - Intronic
985960020 5:3294247-3294269 AATCTCACTCTTGCTCCTGCAGG - Intergenic
987037419 5:14032253-14032275 AACTTCACTTTTGCACTTGTTGG - Intergenic
987579791 5:19775089-19775111 CCATTCACTGCTGCCCCTGCTGG - Intronic
990169726 5:53034378-53034400 AGTCTCACTGTTGCCCCGGCTGG - Intronic
992479917 5:77140458-77140480 AATGTCACTGTAGCCTCTGCAGG - Intergenic
992513194 5:77461806-77461828 AATCTCACTGTTGCCCAAGCTGG - Intronic
997320754 5:132976606-132976628 AAGTTCACTGTTGACACTGTTGG + Intergenic
998061217 5:139120172-139120194 AACTACACTGTGGCAGCTGCTGG + Intronic
998422078 5:141996903-141996925 AAGTTCTCTGTTGCCCAGGCTGG - Intronic
999230319 5:150057876-150057898 AACTTCTCTGTGGCCCTTGAGGG - Intronic
1002989147 6:2221878-2221900 AAGTTTCCTGTTGCCCCTGTGGG - Intronic
1003718381 6:8672876-8672898 AAACTCACTGTTGCCCAAGCTGG - Intergenic
1004037661 6:11939299-11939321 AGTTTCACTGTTGCCCAGGCTGG - Intergenic
1005819248 6:29583652-29583674 AATCTCACTGTTGCCCAGGCTGG - Intronic
1008499437 6:52166109-52166131 AATCTCACTGTTGCCCAGGCTGG + Intergenic
1008981309 6:57487257-57487279 AACTTCCGTGTTGCCCAGGCTGG + Intronic
1009169404 6:60380281-60380303 AACTTCCATGTTGCCCAGGCTGG + Intergenic
1012389649 6:98723181-98723203 AGCTTCACTGTGGCTCCTTCTGG - Intergenic
1012486553 6:99728220-99728242 AACGTCTCTGTTGCCCAGGCTGG + Intergenic
1012805373 6:103886440-103886462 AGCCTCACTGTTGCCCAGGCTGG + Intergenic
1014092805 6:117423871-117423893 CACTTCACTTTTGTCCCTCCAGG + Intronic
1014232817 6:118923000-118923022 AGTTTCACTGTTGCCCAGGCTGG - Intronic
1015368698 6:132425958-132425980 ATCTCCTCTGTTGCCCCAGCTGG + Intergenic
1015559871 6:134503079-134503101 ACCTCCACCTTTGCCCCTGCTGG - Intergenic
1019507108 7:1397111-1397133 AGTCTCACTGTTGCCCCAGCTGG + Intergenic
1020804993 7:12778344-12778366 CACTTTTCTCTTGCCCCTGCAGG - Intergenic
1021552544 7:21886784-21886806 CACATCACTGATGCCCCTTCAGG - Intronic
1022004043 7:26250766-26250788 GACCTCACTGTTGCCCAGGCTGG - Intergenic
1022827483 7:34030649-34030671 GTCTTCTCTGTTGCCCCAGCTGG + Intronic
1024002045 7:45196444-45196466 GACATCACTGTTTCCCCTGCCGG - Intergenic
1024569268 7:50710441-50710463 AAATGCACTCTTGCCTCTGCTGG + Intronic
1025986961 7:66462415-66462437 AAGGTCTCTGTTGCCCATGCTGG - Intergenic
1026028060 7:66763025-66763047 AAGGTCTCTGTTGCCCATGCTGG + Intronic
1026332040 7:69360483-69360505 GTCTTCACTGTTGCCCAGGCTGG + Intergenic
1026883811 7:73924789-73924811 AATCTCACTGTTGCCCAGGCTGG + Intergenic
1027210228 7:76141249-76141271 AAGGTCTCTGTTGCCCATGCTGG - Intergenic
1028251719 7:88545653-88545675 ACCTTCACTCTTACCCCTACAGG - Intergenic
1028361187 7:89968597-89968619 AACTGCACTATTGACCCTCCTGG - Intergenic
1029094484 7:98074182-98074204 AGCCTCACTGTTGCCCAGGCTGG + Intergenic
1029450419 7:100638719-100638741 AGTTTCACTGTTGCCCAGGCTGG - Intronic
1030686109 7:112488626-112488648 AATCTCACTGTTGCCCAGGCTGG + Intronic
1030746289 7:113170557-113170579 AACTTCAATCTTGCCCCTAGTGG + Intergenic
1031373268 7:120993962-120993984 CACTTCACCTTTGCACCTGCAGG - Intronic
1035306464 7:157936202-157936224 AGCTTCACTGCTGCCACTGGAGG + Intronic
1039455312 8:37702053-37702075 AAGTTCACTGTTGGGCCTGGTGG + Intergenic
1039474780 8:37833948-37833970 AACTTCCCTGTCCCCCCAGCTGG + Exonic
1039525828 8:38215228-38215250 AATCTCACTGTTGCCCAGGCTGG - Intergenic
1039863895 8:41484214-41484236 AACTTCACAATTCCCCCTGTGGG - Intergenic
1040475295 8:47771234-47771256 AGATTCACTGTTGCCCAGGCTGG - Intergenic
1040492453 8:47937229-47937251 AACCTCACTGTTGCCCAGGCTGG - Intronic
1040495705 8:47963421-47963443 AATCTCACTGTTGCCCAGGCTGG - Intronic
1042257957 8:66826000-66826022 AATCTCTCTGTTGCCCATGCTGG + Intronic
1042970687 8:74405535-74405557 AAGTTTACTGTTGTCCGTGCTGG + Intronic
1043126967 8:76410064-76410086 AACTTCACAGTTTCCTCTGAAGG + Intergenic
1046061540 8:109145549-109145571 CATTTCACTGTTGCCCAGGCTGG + Intergenic
1048799016 8:138179202-138179224 GTCTTCACAGTTGCCCCAGCTGG + Intronic
1055939797 9:81638652-81638674 GTCTTCACTGTTGCCCAGGCTGG + Intronic
1057345348 9:94245681-94245703 ATCTTCTCTGTTGCCCAGGCTGG - Intergenic
1058647411 9:107143284-107143306 AACTTCACTGCTACCCCACCAGG - Intergenic
1058682546 9:107452681-107452703 AGCCTCACTGTTGCCCAGGCTGG - Intergenic
1058696109 9:107560289-107560311 AATTTCACTGTTACCCAGGCAGG - Intergenic
1058954251 9:109930812-109930834 CCCTTCACTCTTCCCCCTGCTGG - Intronic
1059308202 9:113371004-113371026 AACCCGACTGTAGCCCCTGCTGG + Exonic
1060156017 9:121320292-121320314 AACCTCAGTGTGACCCCTGCTGG - Intronic
1061005206 9:127925076-127925098 AATCTCGCTGTTGCCCCTGTGGG + Intronic
1061058054 9:128234820-128234842 AGCCTCACTGTTGCCCAGGCTGG + Intronic
1061330250 9:129887980-129888002 AAGCTCACTGCTGCCCCAGCCGG - Exonic
1061692601 9:132345819-132345841 AGTTTCACTGTTGCCCAGGCTGG - Intronic
1186547818 X:10469099-10469121 ATTCTCACTGTTGCCCCGGCTGG + Intronic
1186978914 X:14938381-14938403 AACTTCTCTATTGACCCTTCTGG + Intergenic
1189069522 X:37848787-37848809 AACTTCACTTTAGCCTCTGATGG - Intronic
1190129869 X:47737934-47737956 AACATCACTGTTTCCCATTCTGG + Intergenic
1190288679 X:48977352-48977374 AGTTTCACTGTTGCCCAGGCTGG + Intronic
1192315831 X:70050667-70050689 AACGTCACTGTTACCCCTAAAGG - Intergenic
1192982946 X:76366755-76366777 AGCCTCACTGTTGCTGCTGCTGG - Intergenic
1194217338 X:91147524-91147546 ATCTTCTTTGTTGCCCCTGGGGG + Intergenic
1195449610 X:104996431-104996453 AGCTTAACTATTGCCTCTGCAGG - Intronic
1196838835 X:119838803-119838825 CACTACTCTGTTGCCCATGCTGG + Intronic
1197342527 X:125289854-125289876 AGCCTCACTGTTGCCCAGGCTGG + Intergenic
1199241590 X:145553955-145553977 AACCTCCCTCTGGCCCCTGCAGG + Intergenic
1200170075 X:154066151-154066173 GATTTCACTGTTGCCCAGGCTGG + Intronic
1200553851 Y:4611316-4611338 ATCTTCTTTGTTGCCCCTGGGGG + Intergenic
1200971596 Y:9158430-9158452 AACTTCACTGCTGCCCCTGCAGG - Intergenic
1202139422 Y:21705867-21705889 AACTTCACTGCTGCCCCTGCAGG + Intergenic
1202339657 Y:23849760-23849782 AACTTCACTGTTGCCCCTGCAGG - Intergenic
1202531109 Y:25820322-25820344 AACTTCACTGTTGCCCCTGCAGG + Intergenic