ID: 1202538345

View in Genome Browser
Species Human (GRCh38)
Location Y:25901203-25901225
Sequence CACTTGTCCCAGAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202538345_1202538348 -1 Left 1202538345 Y:25901203-25901225 CCTCAGGGCCTCTGGGACAAGTG No data
Right 1202538348 Y:25901225-25901247 GTTCCTTGGAGATTCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202538345 Original CRISPR CACTTGTCCCAGAGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr