ID: 1202539607

View in Genome Browser
Species Human (GRCh38)
Location Y:25915490-25915512
Sequence ACTACAAAATACCCAGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539607_1202539610 20 Left 1202539607 Y:25915490-25915512 CCATGTCCTGGGTATTTTGTAGT No data
Right 1202539610 Y:25915533-25915555 ATATGTGACAAATTCTTTGAAGG No data
1202539607_1202539611 30 Left 1202539607 Y:25915490-25915512 CCATGTCCTGGGTATTTTGTAGT No data
Right 1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539607 Original CRISPR ACTACAAAATACCCAGGACA TGG (reversed) Intergenic
No off target data available for this crispr